← The evidence ledger
Evidence row 1687
Observed , by baseline/1.
- Kind
- listing
- About
- source_record agentic_market:bio-halowerk-com
- Recorded
- Previous row
- None: the first of its kind about this subject
- Body SHA-256
- f77a915eb1dbc612f517ff0d09b35d29c4a61406d226415009837370e605fea4
- Leaf
- 0x83fdd586087cad7c3023691aad8cbe23438ea1f922fa1c3c96eba49d29aeaa9d
What was observed
{
"endpoints": [
[
"x402",
"https://bio.halowerk.com/v1/allergen-epitope"
],
[
"x402",
"https://bio.halowerk.com/v1/biomarker-longevity"
],
[
"x402",
"https://bio.halowerk.com/v1/crispr-offtarget"
],
[
"x402",
"https://bio.halowerk.com/v1/dna-storage-encode"
],
[
"x402",
"https://bio.halowerk.com/v1/microbiome-diversity"
],
[
"x402",
"https://bio.halowerk.com/v1/pathogen-r0"
],
[
"x402",
"https://bio.halowerk.com/v1/phage-matching"
],
[
"x402",
"https://bio.halowerk.com/v1/protein-folding"
],
[
"x402",
"https://bio.halowerk.com/v1/syn-yeast-yield"
],
[
"x402",
"https://bio.halowerk.com/v1/tissue-scaffold"
]
],
"name": "bio.halowerk.com",
"owner_address": null,
"raw": {
"caip2_networks": [
"eip155:8453"
],
"category": "",
"description": "",
"domain": "bio.halowerk.com",
"endpoints": [
{
"description": "Builds amino-acid k-mer sets, calculates Jaccard similarity, and finds the highest contiguous identity between each supplied epitope and any equal-length window of the query. It does not predict immune binding, allergenicity, cross-reactivity or clinical risk and cannot replace curated databases or laboratory testing.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": 3,
"group": "body",
"name": "kmer_size",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": [],
"group": "body",
"name": "known_epitopes",
"required": false,
"type": "array"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": "MKTLLVLLAVASASVQAAPVYIAGQ",
"group": "body",
"name": "query_sequence",
"required": false,
"type": "string"
}
],
"pricing": {
"amount": "0.004",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "5",
"l30DaysUniquePayers": "5"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/allergen-epitope"
},
{
"description": "Standardizes each supplied value against its supplied mean and standard deviation, flips markers whose favorable direction is lower, and computes a weighted composite mapped to a bounded 0–100 index. The references and weights come entirely from the caller; this is not a validated longevity score, diagnosis, prognosis or medical advice.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": [],
"group": "body",
"name": "biomarkers",
"required": false,
"type": "array"
}
],
"pricing": {
"amount": "0.003",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "7",
"l30DaysUniquePayers": "6"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/biomarker-longevity"
},
{
"description": "Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": [],
"group": "body",
"name": "candidates",
"required": false,
"type": "array"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": "GAGTCCGAGCAGAAGAAGAA",
"group": "body",
"name": "guide",
"required": false,
"type": "string"
}
],
"pricing": {
"amount": "0.004",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "5",
"l30DaysUniquePayers": "5"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/crispr-offtarget"
},
{
"description": "Maps each two-bit group of caller-supplied UTF-8 bytes to A, C, G or T and reports a SHA-256 checksum of the original bytes. This reversible representation performs no biological synthesis, homopolymer balancing, GC optimization, addressing or error-correcting code.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": "HALOWERK deterministic DNA storage demo",
"group": "body",
"name": "text",
"required": false,
"type": "string"
}
],
"pricing": {
"amount": "0.003",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "6",
"l30DaysUniquePayers": "5"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/dna-storage-encode"
},
{
"description": "Normalizes non-negative caller-supplied taxon counts and computes observed richness, natural-log Shannon entropy, Simpson diversity and Pielou evenness. It does not perform sequence classification, compositional correction, rarefaction, cohort comparison or medical interpretation.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": [],
"group": "body",
"name": "taxa",
"required": false,
"type": "array"
}
],
"pricing": {
"amount": "0.003",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "6",
"l30DaysUniquePayers": "5"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/microbiome-diversity"
},
{
"description": "Multiplies per-contact transmission probability, effective contacts per day and infectious duration to obtain a simple basic reproduction number, then applies a susceptible fraction for an effective number. It is a classroom homogeneous-mixing calculation, not an outbreak estimate, fitted epidemiological model or public-health forecast.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": 9,
"group": "body",
"name": "effective_contacts_per_day",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": 6,
"group": "body",
"name": "infectious_duration_days",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": 0.72,
"group": "body",
"name": "susceptible_fraction",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": 0.035,
"group": "body",
"name": "transmission_probability_per_contact",
"required": false,
"type": "number"
}
],
"pricing": {
"amount": "0.003",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "8",
"l30DaysUniquePayers": "6"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/pathogen-r0"
},
{
"description": "Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": 2,
"group": "body",
"name": "max_mismatches",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
"group": "body",
"name": "phage_sequence",
"required": false,
"type": "string"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": [],
"group": "body",
"name": "spacers",
"required": false,
"type": "array"
}
],
"pricing": {
"amount": "0.004",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "4",
"l30DaysUniquePayers": "4"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/phage-matching"
},
{
"description": "Checks that a hydrophobic/polar sequence follows a self-avoiding unit-step lattice path, then counts non-consecutive hydrophobic contacts and assigns one negative energy unit per contact. It evaluates a supplied toy conformation only; it neither predicts a fold nor represents atomic chemistry, kinetics, solvent or biological function.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": [],
"group": "body",
"name": "coordinates",
"required": false,
"type": "array"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": "HPPHHPH",
"group": "body",
"name": "hp_sequence",
"required": false,
"type": "string"
}
],
"pricing": {
"amount": "0.004",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "4",
"l30DaysUniquePayers": "4"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/protein-folding"
},
{
"description": "Divides each available substrate mass by its required mass per product mass, selects the limiting substrate, and applies a caller-supplied process efficiency. It does not model yeast metabolism, kinetics, oxygen transfer, toxicity, regulation or actual fermentation performance.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": 0.78,
"group": "body",
"name": "process_efficiency",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": [],
"group": "body",
"name": "substrates",
"required": false,
"type": "array"
}
],
"pricing": {
"amount": "0.003",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "7",
"l30DaysUniquePayers": "6"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/syn-yeast-yield"
},
{
"description": "Uses the Kozeny-Carman relation with supplied porosity and pore diameter, then applies Darcy’s law with supplied thickness, viscosity and pressure drop. It is an idealized homogeneous porous-medium calculation, not scaffold design validation, cell-transport modeling, biocompatibility assessment or medical guidance.",
"method": "POST",
"parameters": [
{
"default": null,
"description": "",
"enumValues": [],
"example": 0.001,
"group": "body",
"name": "fluid_dynamic_viscosity_pa_s",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": 180,
"group": "body",
"name": "kozeny_constant",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": 180,
"group": "body",
"name": "mean_pore_diameter_um",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": 0.72,
"group": "body",
"name": "porosity_fraction",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": 1200,
"group": "body",
"name": "pressure_drop_pa",
"required": false,
"type": "number"
},
{
"default": null,
"description": "",
"enumValues": [],
"example": 4,
"group": "body",
"name": "scaffold_thickness_mm",
"required": false,
"type": "number"
}
],
"pricing": {
"amount": "0.003",
"currency": "USDC",
"maxAmount": "",
"minAmount": "",
"network": "eip155:8453",
"scheme": "exact"
},
"providerName": "",
"quality": {
"l30DaysTotalCalls": "6",
"l30DaysUniquePayers": "6"
},
"serviceName": "",
"tags": [],
"url": "https://bio.halowerk.com/v1/tissue-scaffold"
}
],
"enriched": false,
"iconUrl": "",
"id": "bio-halowerk-com",
"integrationType": "",
"isNew": false,
"name": "bio.halowerk.com",
"networks": [
"Base"
],
"priceSummary": {
"avgCostBasis": "exact",
"avgCostPerTransaction": "0.0034",
"currency": "USDC",
"maxAmount": "0.004",
"minAmount": "0.003"
},
"provider": "bio.halowerk.com",
"providerUrl": "",
"serviceName": "",
"tags": []
},
"source": "agentic_market",
"summary": ""
}What the leaf hashes
{"body":"f77a915eb1dbc612f517ff0d09b35d29c4a61406d226415009837370e605fea4","id":1687,"kind":"listing","method":"baseline/1","observed_us":1793025254562878,"prev":null,"subject":"agentic_market:bio-halowerk-com","subject_kind":"source_record"}Proof
Fold these into the leaf in order, hashing each sorted pair with keccak256, to reach the root of (296695 rows).
- 0x83fdfafd7e3a8deaa569d875deeb77f0bcd01c6788c24affb1c012d033861928
- 0x5ad1b6d9bb9afb3c8fe52507465c98f6512cf163f8fbd8d631fb9554268c9a27
- 0x7bfcc65a65ebc23df5256b098633a25269f9876e55fe4b2a214c6b04bd4c8cba
- 0xd9429789a2ce7c5d03665ea0fef95aa099d8b94fe2f75d0bb932e64c8f2d4827
- 0x582d6475f4093ee7e90bdab31a0fc7fc46d5ed87c3a266a542d5ed5a41a4c536
- 0x0b48817931c03c365e8e95575e842bd72c40dd4d115eed1ed6cfbebb10c705e2
- 0xe118fb0bfc5787ad669572caff6dbb138047e69d56ef729f6ef3a548a8144ffa
- 0xbb153c623f4b74f88aa2c4466eb78eb53dbb6caac59628b53b20dfc47a862f07
- 0xa5e9a7d3f11a078919b79a649d5cac45bb07a6061d20bee3b964c61c255e4415
- 0x18033a2c4d97bdf70116da2594b654dbb6f1d12267646015d8db5a14fd3724c4
- 0xdb4295ae338449b07243daebee8c36f16b3aaca1599a8f860eb80e22bca21e79
- 0xfdaa032291ded0df2cf35d6e9dc6e7a2643d0fe027dd3ab321971f1f7bf69147
- 0x91c2ae93ec20c7fed5088112fe3941ca622dfb3f8f1022c4844726c361244bd4
- 0x0eff463856b0992d53ab7d8c0b97c71541413358bdd445710c1e4b6aeb4d8f78
- 0x7eb603d37f0f22dae1ea013e391889906ffc0139ff26e25b044bee38eec8f9b2
- 0x2b6e23e3624a1b66e1d2298cfbce99a93ce6b13d24a58112a71802d79c5f7a76
- 0xd21942ae3214eff88e08ab04884fd4b11958b51af9a0741b7668e2d07a2c56c9
- 0x9a9024edb5069d88a324facb310a5ce8e495214bbaa968f077bede437390194f
- 0x9b9ce5b74b9bab5121612ef6b64920a8d453cbf311096a423eef9702747e868a
- Day root
- 0xf43e8dcc3d451a4788b26be904c55e8c4c0fa75c9666796c51db38d37e2c0df8
- Chained
- 0x702d5ac508f08b0d1accf36af25822d8e5660367494edd17a642fb61e158a57a
- Published
- On Arc Testnet, block 69251483: 0x495162f8936e19f0039918feebe6c307f327cd6bf8c37219620b1970041fa9ae